Real time qRT-PCR expression profiling
results03

Relative gene expression levels of the identified proteins and controls have been examined using real-time quantitative reverse-transcription PCR (real-time qRT-PCR). Total RNA was isolated from three independent experiments, before and after NGF stimulation (24 hours) of PC12 cells. Expression of each gene was assayed using three replicates for each primer, including the actin-specific primer that was used as an internal standard. Negative controls lacking the cDNA template were run with every assay to assess specificity. Gene-specific primer sets were designed using online design tool from https://www.roche-applied-science.com/sis/rtpcr/upl/adc.jsp.
A threshold cycle ( Ct ) was determined for each gene using the exponential-growth phase and the baseline signal from fluorescence versus cycle number plots. Fold change after NGF treatment for each gene is calculated in the following way:

DCt(gene) = Ct(gene, NGF) - Ct(gene, no NGF)
DCt(standard) = Ct(standard, NGF) - Ct(standard, no NGF)
DDCt = DCt(gene) - DCt(standard) 

(Positive DDCt values indicate more PCR cycles and therefore less targeted gene’s mRNA after NGF treatment, meaning inhibition of targeted gene’s expression. Conversely, negative DDCt values indicate more mRNA after NGF stimulation, indicating induction of gene expression. This is called relative quantitation method)

Due to exponential nature of PCR, “fold change” was calculated as 2-DDCt. The results are shown as “fold change” +/- S.D.

Proteins that change the number of neurites per cell

Protein Name

Swissprot ID

primer pair used

fold change +/- S.D.

coiled-coil domain containing 8, CCDC8

Q9H0V0

5' gttgggggaacccaactt 3'
5' cagtgtcgcctccctgtaat 3'

3.59 +/- 0.54

frizzled homolog 7, FZD7

Q96B74

5' cgcctttcactgcgatgt 3'
5' gcaagagaaggggaaagacc 3'

1.31 +/- 0.21

cholinergic receptor, muscarinic 2, CHRM2, isoform a (Hypothetical protein)

Q4VBK6

5' gcatccccaatacagtatggac 3'
5' cggattgatggtgctattga 3'

1.19 +/- 0.14

Hypothetical protein

Q69YW2

5' cacaaagacgccgagacc 3'
5' cttctcgcgaacctgcac 3'

0.99 +/- 0.01

Microtubule-associated protein, RP/EB family, member 3

Q9UPY8

5'aaaggattacaaccctctgctg 3'
5'ggacgtcctctgtggaactg 3'

2.7 +/- 0.96

Proteins that change the neurite length

Protein Name

Swissprot ID

primer pair used

fold change +/- S.D.

Gamma-BAR, AP-1 interacting protein

Q9H0W5

5' gaatgacgacagcacctcct 3'
5' ggcagcatcctattcattcc 3'

1.65 +/- 0.13

SACM1L

Q9NTJ5

5' agtttattagctcggcgttcc  3'
5' tcccacatgcaaaactccta 3'

1.61 +/- 0.05

Proteins that block the neurite outgrowth

Protein Name

Swissprot ID

primer pair used

fold change +/- S.D.

Transmembrane 4 superfamily member 10, TM4SF10

Q9BQJ4

5' gttgctgtcatgctttttgc 3'
5' ttttcaagctcacagtttcaataaa  3'

2.04 +/- 0.16

Hypothetical protein, zinc and ring finger 1, ZNRF1

Q9H083

5' tggaggagctgcttcagg 3'
5' tcacttcaaaccatgagtctatgc 3'

1.4 +/- 0.34

Hypothetical protein

Q9BQI0

5' tcctaccgagactttgtgaacat  3'
5' ttccttcaaacatcatgaccag 3'

0.58 +/- 0.02

Hypothetical protein

Q9Y4P9

5' acctctcccgggatttca 3'
5' gggacataattgtgcatctcc  3'

1.33 +/- 0.14

CRIB-containing BORG2 protein

Q9UKI2

5' gaatccctttccgacctgac 3'
5'aaaagtgagggccccaga 3'

0.69 +/- 0.05

Kinesin family member 2C, KIF2C

Q99661

5' gccatttcccattcacaca  3'
5' catcaacaacggtaattctgtca  3'

0.26 +/- 0.1

Microtubule-associated protein, RP/EB family, member 2

Q15555

5' tcctacagttggggaatggc 3'
5'acccatgcaatgatgtcatg 3'

0.53 +/- 0.18

Proteins used as controls, proteins - components of the proposed pathway and others

Protein Name

Swissprot ID

primer pair used

fold change +/- S.D.

Adenomatous polyposis coli protein (APC protein)

P25054

5' aaggcatggaccaggaca 3'
5' cagggcagatctgatgctc 3'

2.79 +/- 0.36

Glycogen synthase-kinase 3 beta (GSK3 beta)

P49841

5' cacatccttggacgaaggtc 3'
5' aggagacggctacacagtgc 3'

1.38 +/- 0.36

Partitioning defective 6 clone alpha (Par6-alpha)

Q9NPB6

5' cgcctgttggtccagaaa 3'
5' gtagagagttggaggcaaaagc 3'

0.56 +/- 0.10

Cell division cycle 42, CDC42

P60953

5'ggctgtcaagtatgtggagtgt 3'
5' ggctcttcttcggttctgg 3'

1.14 +/- 0.09

Protein kinase C, type zeta (PKCz)

Q05513

5' tgaagaaggagctcgtccac 3'
5' gttgctggatgcctgctc 3'

1.11 +/- 0.02

Ras-related protein RAB5A

P20339

5'gctaagacatcaatgaatgtaaatgaa 3'
5' tgtgcaggctcagtaaggtc 3'

2.32 +/- 0.45

Microtubule-associated protein, RP/EB family, member 1

Q15691

5' atgacgaagctgctgaattg 3'
5' ctccttctccaagtcttcaacag 3'

1.17 +/- 0.2

Kinesin-like protein KIF3C

O14782

5' gaagatgctggaggatctgaa 3'
5' ccccaatgagtagcttgctt 3'

2.04 +/- 0.003

Rab GTPase binding effector protein 1 (rabaptin-5)

Q15276

5' ctgacagaagctgaagacaagatt 3'
5' cggcctccagataatgattc 3'

1.26 +/- 0.06

neurofilament triplet M protein (NF-M) (positive control)

P07197

5' cgtcatttgcgagaatacca 3'
5' tcttcaccctccagtagtttcc 3'

4.56 +/- 0.05

Cdc42 effector protein 2 (Borg1)

O14613

5' ggacctggggccttctatc 3'
5'cggcctaggtcctgatcc 3'

0.84 +/- 0.22

Cdc42 effector protein 5 (Borg3)

Q6NZY7

5' gcgtggagcactctctatctc 3'
5' gcttcccacgtgcaatgt 3'

1.32 +/- 0.79

Cdc42 effector protein 4 (Borg4)

Q9H3Q1

5' tcctcagcatcatggacaag 3'
5' ggtaaatgccgccttcct 3'

1.42 +/- 0.5

Cdc42 effector protein 1 (Borg5)

Q00587

5' cactccggctagctccac 3'
5' gcgtgagatggtgcagaac 3'

1.21 +/- 0.07